Answer to Question #74666 in Microbiology for Chevel Johnson

Question #74666

you sequence the DNA of the tryptophanase operon promoter and obtain the DNA sequence shown below. Underline and name the two critical regions needed for binding the sigma 70 factor -40 AGAATAGACAAAAACTCTGAGTGTAATAATGCCTCGTAGATCG +6

Expert's answer

Answer in progress...

Learn more about our help with Assignments: Microbiology

Comments

No comments. Be the first!

Leave a comment

Related Questions

1. I am doing a project over microbes in our foods and I picked chocolate for my research. Can you help
2. May I know the recommended dilution factors for the strain Acetobacter nitrogenifigens sp. if i am p
3. what is common between ameoba and elephant
4. Question 15 : Atmospheric nitrogen is directly useable by most organisms but has to be converted to
5. Help identifying some bacteria upon CLED agar. 1) Yellow colonies, gram positive cocci, catalase po
6. List the central chemoreceptors in alphabetical order!?
7. Where is growth of white yeast saccharomyces cerevisiae in stab cultures draw an image And write a

Who Can Help Me with My Assignment

There are three certainties in this world: Death, Taxes and Homework Assignments. No matter where you study, and no matter…
How to Finish Assignments When You Can’t

Crunch time is coming, deadlines need to be met, essays need to be submitted, and tests should be studied for.…
How to Effectively Study for a Math Test

Numbers and figures are an essential part of our world, necessary for almost everything we do every day. As important…