In November 2024
Answer to Question #161593 in Molecular Biology for Virat
The polypeptide consists of the following amino acids: valine - alanine - glycine - lysine - tryptophan - valine - serine - glutamic acid - determine the amino acid sequence using the genetic code.
Assuming that the question requires us to determine the base sequence using the genetic code;
We will use the RNA genetic code
The answer will be;
AUGGUAGCAGGAAAGUGGGUAUCAGAGUAA
The first and the last codons being Start and Stop codons respectively
-
![Help me with my assignment!]()
Who Can Help Me with My Assignment
There are three certainties in this world: Death, Taxes and Homework Assignments. No matter where you study, and no matter…
-
![How to finish assignment]()
How to Finish Assignments When You Can’t
Crunch time is coming, deadlines need to be met, essays need to be submitted, and tests should be studied for.…
-
![Math Exams Study]()
How to Effectively Study for a Math Test
Numbers and figures are an essential part of our world, necessary for almost everything we do every day. As important…
Comments
Leave a comment