Answer to Question #199324 in Bioinformatics for Muhammad Farooq

Question #199324

A scientist sequencing mRNA identifies the following strand:

CUAUGUGUCGUAACAGCCGAUGACCCG

What is the sequence of the amino acid chain this mRNA makes when it is translated?

Expert's answer

Met Cys Arg Asn Ser Arg

Learn more about our help with Assignments: Bioinformatics

Comments

No comments. Be the first!

Leave a comment

Related Questions

1. pattern and profile used in the sequence analysis for functional assignment
2. Here are two motifs. Which of the following matches them?[QAPRG]-X-D-Q-X-{RT}-X-SA. QQQQQQQSB. PP
3. 1. For the sequence below, answer the following questions.a) Identify the protein and speciesb)
4. 1. For each seq:a) Identify the protein and speciesb) At approx what amino acid number is the mo
5. Name two traits in human two discrete variation and discontinuous variation.
6. Suppose you have an n×n additive matrix M with n ≥ 4, and you erase the entriescorresponding to t
7. 1. Look at the table (right) showing survival of a group of 20 pancreatic cancer patients t