Bioinformatics Answers

(a) Explain the energy landscape model for protein folding with appropriate illustrations.

(b) What is the principle of minimal frustration?

(a) Hidden Markov models (HMM) are used to identify genes in genome sequencing projects. Describe how you would build a hidden Markov model to identify genes in a genome sequence.

(b) Give one other application of hidden Markov models.

(a) Explain sensitivity and selectivity in terms of true and false positives.

(b) What is the advantage of a Needleman-Wunsch alignment compared to a seeded alignment?

(c) What does the expectation parameter mean in local alignment? What will happen if the expectation value is increased from its default value of 10 to a 100?

Two proteins have 20 % sequence identity. Is this likely to be significant? What other simple piece of information do you need to answer this question properly?

1.   Search for plant omega-3 desaturase (delta-15 desaturase) gene from GenBank and retrieves at least three (3) omega-3 desaturase gene sequences from different plant species or microalgae that share high homology.

a)     Perform multiple alignments on the sequences using Clustal Omega [3 M]. Provide your analysis materials (multiple alignment) as in appendix for proof [3 M].

(b) For the given DNA coding sequence, generate an RNA sequence.

DNA Sequence: CGATGCCTCGCTAGAGGCTCGAAAGCTCTTTCGGAGATAATCG

RNA Sequence:

String Parenthesis Representation:

Arch Diagram:

A continuous culture is operated at steady state using glucose as a limiting substrate. The  conditions are So (feed glucose) = 20 g/L, S = 0.02 g/L, X =10 g/L, and D = 0.25 h−1. Now, D is changed to 0.3 h−1 and So to 15 g/L. The new D is 90% of the maximum specific  growth rate. What is the cell concentration (X) at the new steady state? Assume that the  growth is described by the Monod model.