will the operon continue if the lacy is deleted
how does your body change the starch molecules into fat molecules?
I am doing an investigation on the distribution of catalase enzyme in potato tissue. I would like to know what affects how an enzyme is distributed in potatoes. Is potato tissue more active on the inside core or on the outside skin?
GCGGCGGATTGCTAGGCCAATCGTCATTGCTGACTATAATAAAAGCTTAAGCCCTTTCCGCT
GTCGCCTTCACTTGCCGTATGCGATGTTTCCTTCAGCTCCAGGTACAGGTAAGTAGTTAATGCAG
CCCCAGTTTCAGTTGCGGGTCCTTCAGCTCCATTTCCTTTTTAGCCGTACATATGGCAATAAAGCTAAGCT
AGGCTATCGTTCAGTACCGATTCGTGGTGTGCGGG
what are the cis elements here?
Hello,
I would like to ask you one specific question - We need RNA polymerase to make a protein, but RNA polymerase is made up of proteins. So how does RNA polymerase, or its subunits, appear in the first place?
during elongation occuring in translation the enzyme which catalyses the synthesis of peptide bond is
Below is the protocol to make 1 liter of 10* concentrate PBS.
Combine the following:
80g NaCl
2g KCl
14.4g Na2HPO4 (dibasic anhydrous)
2.4g KH2PO4 (monobasic anhydrous)
800ml distilled H2O
adjust pH to 7.4 with HCl
add H2O to 1L
autoclave for 20 minutes on liquid cycle. store at room temperature.
What is the first step to attempt the question, this is my first time doing Biology
THE MAD RUSH DOWNSTAIRS: FREE ENERGY AS THE DRIVING FORCE BEHIND CHEMICAL REACTIONS
Write out and explain the intuitive meaning of the equation for the free energy change in a chemical reaction,
and draw an accompanying color-coded and labeled graph of the equation. Talk about what drives chemical reactions
inside living cells. Be sure to carefully define all the terms in the equation, and give intuitive explanations of how changing the independent variables in the equation change the "delta G" value and thereby determine whether the
reaction goes forward, backward, or is at equilibrium. Use the hydrolysis of nucleotides in the formation of RNA
and DNA to illustrate the thermodynamic principles that allow cells to run the chemical reactions that sustain life.
At the very end, address the question of whether the chemical reactions occurring inside a living cell are at equilibrium,
or away from equilibrium, and why that has to be the case for life to go on.
If tryptophan is absent from the environment of E.coli, the trp operon will be _______